This is an embeddable component that you can include in your website to visualise RNA secondary structures.
Only two lines of code are needed to use this widget: one line with the r2dt-web tag and another with the script for this component, for example:
<r2dt-web/>
<script type="text/javascript" src="/path/to/r2dt-web.js"></script>
And then the component provides a simple input box where you can paste an RNA/DNA sequence, URL or job ID.

To use the latest stable version without worrying about updates, use the component’s JavaScript package available at GitHub:
<script type="text/javascript" src="https://rnacentral.github.io/r2dt-web/dist/r2dt-web.js"></script>
If you prefer to install this package and perform the updates manually, see the Installation section.
If you already have an external URL that returns an SVG generated by R2DT, you can provide it through the
search attribute as a JSON object.
<r2dt-web search='{"url": "https://example.com/svg"}'></r2dt-web>
To load an RNAcentral identifier (URS), pass it in the same way:
<r2dt-web search='{"urs": "URS0000049E57"}'></r2dt-web>

Click here to see how you can find an RNAcentral identifier for an RNA sequence.
If neither url nor urs is provided, the component will display a search field. You can optionally display example
sequences using the examples attribute.
<r2dt-web
examples='[
{"description": "RNA5S1-8", "sequence": "GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAGGGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGCUUU"},
{"description": "TRT-TGT2-1", "sequence": "GGCTCCATAGCTCAGTGGTTAGAGCACTGGTCTTGTAAACCAGGGGTCGCGAGTTCGATCCTCGCTGGGGCCT"}
]'
/>

Clone this repository from GitHub.
git clone https://github.com/RNAcentral/r2dt-web.git
Now you can add the component’s JavaScript bundle (it contains all the styles and fonts) to your web page either directly or through an import with Webpack:
<script type="text/javascript" src="/r2dt-web/dist/r2dt-web.js"></script>
This component accepts a number of attributes. You pass them as html attributes and their values are strings (this is a requirement of Web Components):
| parameter | description |
|---|---|
| search | JSON object with url or urs attributes |
| examples | Array of example sequences with description and sequence |
| legend | Legend position (left by default). Can be left, right and center |
npm install
npm run update-templates to use the latest models from the R2DT repository
npm start to start a server on http://localhost:9000/
npm run build to generate a new distribution
npm test to run unit tests
url and urs are provided, urs takes precedence.